ID: 1073306058_1073306074

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1073306058 1073306074
Species Human (GRCh38) Human (GRCh38)
Location 10:102504204-102504226 10:102504246-102504268
Sequence CCTGGCCCGACTGCCCCCCCGGC CCGGGACTGCACGCCATCTACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 416} {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!