ID: 1073339571_1073339583

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1073339571 1073339583
Species Human (GRCh38) Human (GRCh38)
Location 10:102734899-102734921 10:102734949-102734971
Sequence CCTTCCCCAGACCCCCTCAGTTG AGTTATATGCACAGTGAAGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!