ID: 1073372962_1073372963

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1073372962 1073372963
Species Human (GRCh38) Human (GRCh38)
Location 10:103007189-103007211 10:103007212-103007234
Sequence CCTGTACGAACAGGGAGTAGGTC ACAAAGATCACATGCTTCAAAGG
Strand - +
Off-target summary No data {0: 262, 1: 328, 2: 421, 3: 253, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!