ID: 1073440109_1073440119

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1073440109 1073440119
Species Human (GRCh38) Human (GRCh38)
Location 10:103547514-103547536 10:103547567-103547589
Sequence CCTCTGTAAGCTGGACCTGGGAG CAGAATCCCCAGAGGAAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 234} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!