ID: 1073533044_1073533047

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1073533044 1073533047
Species Human (GRCh38) Human (GRCh38)
Location 10:104250576-104250598 10:104250601-104250623
Sequence CCTTTTAACTGTGGCTATGGGCA ATGTCAACATAAAAGGAAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 62, 4: 495}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!