ID: 1073535088_1073535096

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1073535088 1073535096
Species Human (GRCh38) Human (GRCh38)
Location 10:104269167-104269189 10:104269193-104269215
Sequence CCCCGTCTAGGCCCCGCCTCCTT GCTGCTGCCGCCGCCAATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 216} {0: 1, 1: 0, 2: 2, 3: 25, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!