ID: 1073535090_1073535102

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1073535090 1073535102
Species Human (GRCh38) Human (GRCh38)
Location 10:104269169-104269191 10:104269214-104269236
Sequence CCGTCTAGGCCCCGCCTCCTTGC GGTCCGGTTGCCCGAGTTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 290} {0: 1, 1: 0, 2: 1, 3: 2, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!