ID: 1073535093_1073535107

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1073535093 1073535107
Species Human (GRCh38) Human (GRCh38)
Location 10:104269180-104269202 10:104269227-104269249
Sequence CCGCCTCCTTGCTGCTGCTGCCG GAGTTCCCGGAGGTCTCTCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 579} {0: 1, 1: 0, 2: 0, 3: 4, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!