ID: 1073544101_1073544111

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1073544101 1073544111
Species Human (GRCh38) Human (GRCh38)
Location 10:104334718-104334740 10:104334770-104334792
Sequence CCGCAGAGGTAGACAAAGCCCTG CACCCCATGCTGCTCCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 306} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!