ID: 1073735248_1073735250

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1073735248 1073735250
Species Human (GRCh38) Human (GRCh38)
Location 10:106337469-106337491 10:106337490-106337512
Sequence CCTCAAGGATGGCTTCTATCAGG GGTGTTTGATGATTGAAGAAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!