ID: 1073799513_1073799521

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1073799513 1073799521
Species Human (GRCh38) Human (GRCh38)
Location 10:107026039-107026061 10:107026072-107026094
Sequence CCACCATAGGTTGCAGGATTGAG ACACATCAAAAGGAAATCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!