ID: 1073959158_1073959163

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1073959158 1073959163
Species Human (GRCh38) Human (GRCh38)
Location 10:108906081-108906103 10:108906103-108906125
Sequence CCTGAGCTGCCACACCTGCTCAG GGGTTGTTATCTGCCTTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 366} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!