ID: 1074009124_1074009130

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1074009124 1074009130
Species Human (GRCh38) Human (GRCh38)
Location 10:109458623-109458645 10:109458673-109458695
Sequence CCAAGAGCATGGCACCAGCATCT CAGTGTCATCCCATGGAAGAAGG
Strand - +
Off-target summary {0: 27, 1: 81, 2: 206, 3: 346, 4: 989} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!