ID: 1074073544_1074073554

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1074073544 1074073554
Species Human (GRCh38) Human (GRCh38)
Location 10:110098752-110098774 10:110098801-110098823
Sequence CCCGAGTAGCTGTGATTACAGGC TTGTATTTTCAGTAAAGGCGGGG
Strand - +
Off-target summary No data {0: 3, 1: 229, 2: 8907, 3: 122382, 4: 228424}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!