ID: 1074073545_1074073554

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1074073545 1074073554
Species Human (GRCh38) Human (GRCh38)
Location 10:110098753-110098775 10:110098801-110098823
Sequence CCGAGTAGCTGTGATTACAGGCA TTGTATTTTCAGTAAAGGCGGGG
Strand - +
Off-target summary {0: 522, 1: 57111, 2: 105870, 3: 158095, 4: 236817} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!