ID: 1074073549_1074073554 |
View in Genome Browser |
Spacer: -10 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1074073549 | 1074073554 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 10:110098788-110098810 | 10:110098801-110098823 |
Sequence | CCCAACTAATTTTTTGTATTTTC | TTGTATTTTCAGTAAAGGCGGGG |
Strand | - | + |
Off-target summary | No data | {0: 3, 1: 229, 2: 8907, 3: 122382, 4: 228424} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |