ID: 1074264105_1074264116

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1074264105 1074264116
Species Human (GRCh38) Human (GRCh38)
Location 10:111883808-111883830 10:111883854-111883876
Sequence CCAAGCCCTAGGCCTTAAGTCCA GGCCAGTGTAAGCACGGTCAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!