ID: 1074382549_1074382560

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1074382549 1074382560
Species Human (GRCh38) Human (GRCh38)
Location 10:112992343-112992365 10:112992378-112992400
Sequence CCCCCAGCCCTGGGAGGGATGCA GACACCCAGACCCGACAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 395} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!