ID: 1074567159_1074567161

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1074567159 1074567161
Species Human (GRCh38) Human (GRCh38)
Location 10:114590540-114590562 10:114590573-114590595
Sequence CCGTACTTCTCACTAAAGGTTCT ATGTGAATAAGGAGAAACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 142} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!