ID: 1074754689_1074754700

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1074754689 1074754700
Species Human (GRCh38) Human (GRCh38)
Location 10:116615666-116615688 10:116615712-116615734
Sequence CCTTGGGCCTTCTTGGTGCCATG GTGCTACTGGGTGGCAGCCTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!