ID: 1074768174_1074768182

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1074768174 1074768182
Species Human (GRCh38) Human (GRCh38)
Location 10:116715986-116716008 10:116716028-116716050
Sequence CCACTGGCCCCCTCGCAGATGAC CAGCTGAGCAGCTCCCACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 135} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!