ID: 1075076303_1075076314

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1075076303 1075076314
Species Human (GRCh38) Human (GRCh38)
Location 10:119352935-119352957 10:119352970-119352992
Sequence CCGTCCTCCCTCTCTCTCCCCTG TGCTTTTCACTTCTTATCTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 96, 3: 891, 4: 6264} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!