ID: 1075088502_1075088508

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1075088502 1075088508
Species Human (GRCh38) Human (GRCh38)
Location 10:119429901-119429923 10:119429943-119429965
Sequence CCTGCTGGGCAGACTGAGATGCA GACCTCCTTCGCGTCCTTTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!