ID: 1075140827_1075140831

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1075140827 1075140831
Species Human (GRCh38) Human (GRCh38)
Location 10:119833643-119833665 10:119833665-119833687
Sequence CCTGGGTGATACAGTGAGACCCC CACTGACCAAATAAAATGTCTGG
Strand - +
Off-target summary {0: 4, 1: 182, 2: 3400, 3: 31921, 4: 104724} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!