ID: 1075254124_1075254137

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1075254124 1075254137
Species Human (GRCh38) Human (GRCh38)
Location 10:120910903-120910925 10:120910956-120910978
Sequence CCTAATCCCATCATGGGGTCAAC CCTCGAGGGAGGAGCCAAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 54, 3: 283, 4: 879}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!