ID: 1075545251_1075545262

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1075545251 1075545262
Species Human (GRCh38) Human (GRCh38)
Location 10:123350369-123350391 10:123350411-123350433
Sequence CCCGTGAGCCAGCACAGAGGACC GGCTTGGAGGCAGTAGGACAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 40, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!