ID: 1075717389_1075717391

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1075717389 1075717391
Species Human (GRCh38) Human (GRCh38)
Location 10:124564828-124564850 10:124564856-124564878
Sequence CCATATATTTAAATGAATTAACA TGCAATGATCTGGATGAGATTGG
Strand - +
Off-target summary No data {0: 5, 1: 42, 2: 305, 3: 362, 4: 585}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!