ID: 1075841300_1075841304

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1075841300 1075841304
Species Human (GRCh38) Human (GRCh38)
Location 10:125506467-125506489 10:125506503-125506525
Sequence CCACCATGGCACACGTATACCTA CACGTTCCGCACATGTATATTGG
Strand - +
Off-target summary {0: 293, 1: 3744, 2: 8244, 3: 27622, 4: 12077} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!