ID: 1075841301_1075841304

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1075841301 1075841304
Species Human (GRCh38) Human (GRCh38)
Location 10:125506470-125506492 10:125506503-125506525
Sequence CCATGGCACACGTATACCTACGT CACGTTCCGCACATGTATATTGG
Strand - +
Off-target summary {0: 16, 1: 434, 2: 4101, 3: 6733, 4: 6058} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!