ID: 1075985783_1075985791

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1075985783 1075985791
Species Human (GRCh38) Human (GRCh38)
Location 10:126784000-126784022 10:126784040-126784062
Sequence CCACCCACTGGTACACTCTAAAA CTGGATGGTTCCTCTCTCTAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!