ID: 1075997521_1075997530

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1075997521 1075997530
Species Human (GRCh38) Human (GRCh38)
Location 10:126890618-126890640 10:126890643-126890665
Sequence CCTTGCCTGCCGTTCTGTTGCGG AGTCAGGGACCCCAAACGGAGGG
Strand - +
Off-target summary No data {0: 238, 1: 546, 2: 506, 3: 442, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!