ID: 1075997524_1075997536 |
View in Genome Browser |
Spacer: 27 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1075997524 | 1075997536 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 10:126890623-126890645 | 10:126890673-126890695 |
| Sequence | CCTGCCGTTCTGTTGCGGGAAGT | GAAGCCATGGCAGAAGAACGTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 162, 1: 230, 2: 73, 3: 35, 4: 206} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||