ID: 1076171672_1076171677

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1076171672 1076171677
Species Human (GRCh38) Human (GRCh38)
Location 10:128325146-128325168 10:128325181-128325203
Sequence CCTTGCAGGGGCCCTGGAAACAA TTTTGAATGTGCACACACCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!