ID: 1076171674_1076171679

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1076171674 1076171679
Species Human (GRCh38) Human (GRCh38)
Location 10:128325158-128325180 10:128325196-128325218
Sequence CCTGGAAACAAACACCAGCATGA CACCAGGGCTTACAGCTGAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!