ID: 1076368903_1076368920

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1076368903 1076368920
Species Human (GRCh38) Human (GRCh38)
Location 10:129939259-129939281 10:129939311-129939333
Sequence CCCTCCACCCTCCCCTCTCCCAG ACTGACAAATACGAAGGACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 27, 3: 320, 4: 3035} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!