ID: 1076413668_1076413673

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1076413668 1076413673
Species Human (GRCh38) Human (GRCh38)
Location 10:130269823-130269845 10:130269858-130269880
Sequence CCTCATAGTGAGCACCAAGACCT CTGCTGGAACAGCTTGTCCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!