ID: 1076426825_1076426829

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1076426825 1076426829
Species Human (GRCh38) Human (GRCh38)
Location 10:130372950-130372972 10:130372980-130373002
Sequence CCCGTTCGTCGCTGTCCAGCCAA TCCCTCTCCTCTCTACCTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 70, 4: 740}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!