ID: 1076517523_1076517525

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1076517523 1076517525
Species Human (GRCh38) Human (GRCh38)
Location 10:131056466-131056488 10:131056481-131056503
Sequence CCACGCTGGCGTGACTGAGACGC TGAGACGCCCTCTGTGGAAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!