ID: 1076525397_1076525401

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1076525397 1076525401
Species Human (GRCh38) Human (GRCh38)
Location 10:131109517-131109539 10:131109538-131109560
Sequence CCGCCTCAGTGGGAGAACAACAG AGGGTCTTGTTCTGTCCCCCCGG
Strand - +
Off-target summary No data {0: 11, 1: 639, 2: 8320, 3: 40786, 4: 112016}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!