ID: 1076544889_1076544891

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1076544889 1076544891
Species Human (GRCh38) Human (GRCh38)
Location 10:131238594-131238616 10:131238615-131238637
Sequence CCTCCATGTTCATTATCTCTGGT GTGCTTGTTCAAGCTTGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 171} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!