ID: 1076701433_1076701439

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1076701433 1076701439
Species Human (GRCh38) Human (GRCh38)
Location 10:132275244-132275266 10:132275263-132275285
Sequence CCATGGCTACTCACAGACAGCCC GCCCCACAGGGCCGCTGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 163} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!