ID: 1076712581_1076712585

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1076712581 1076712585
Species Human (GRCh38) Human (GRCh38)
Location 10:132346755-132346777 10:132346798-132346820
Sequence CCCTAAATCAGTTGTCCACAGGC TTTCTAGTCACTTGTACCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!