ID: 1076758409_1076758417

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1076758409 1076758417
Species Human (GRCh38) Human (GRCh38)
Location 10:132587391-132587413 10:132587426-132587448
Sequence CCCATGGTGTGCTCTGTGGGGCT GGCATGGCCTGTGTGATTCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 149} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!