ID: 1076827579_1076827584

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1076827579 1076827584
Species Human (GRCh38) Human (GRCh38)
Location 10:132977036-132977058 10:132977057-132977079
Sequence CCCCTGAAGTCTTGGGGATGACC CCTCGCGTCCCAGGCAGTCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 9, 4: 116} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!