ID: 1076830763_1076830776

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1076830763 1076830776
Species Human (GRCh38) Human (GRCh38)
Location 10:132993026-132993048 10:132993068-132993090
Sequence CCCCCGGCGGACTCCAGGCATAC GCGAGGCCATCCGTGGCTGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!