ID: 1076936965_1076936974

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1076936965 1076936974
Species Human (GRCh38) Human (GRCh38)
Location 10:133572156-133572178 10:133572169-133572191
Sequence CCTTTCCCCCTTTTTCCTGCTGG TTCCTGCTGGGAGTGGGACTTGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 2, 3: 32, 4: 364}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!