ID: 1076936971_1076936983

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1076936971 1076936983
Species Human (GRCh38) Human (GRCh38)
Location 10:133572163-133572185 10:133572212-133572234
Sequence CCCTTTTTCCTGCTGGGAGTGGG ATCGGAAGACCCCAGGATGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!