ID: 1077008662_1077008674

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1077008662 1077008674
Species Human (GRCh38) Human (GRCh38)
Location 11:370443-370465 11:370483-370505
Sequence CCCGGCGGGGGCGCCTTCGGTGA GGGGTCCATGCGTAGGGATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108} {0: 1, 1: 0, 2: 0, 3: 1, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!