ID: 1077008663_1077008676

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1077008663 1077008676
Species Human (GRCh38) Human (GRCh38)
Location 11:370444-370466 11:370493-370515
Sequence CCGGCGGGGGCGCCTTCGGTGAA CGTAGGGATGGGGCCCAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 33} {0: 1, 1: 0, 2: 1, 3: 13, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!