ID: 1077008663_1077008678

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1077008663 1077008678
Species Human (GRCh38) Human (GRCh38)
Location 11:370444-370466 11:370495-370517
Sequence CCGGCGGGGGCGCCTTCGGTGAA TAGGGATGGGGCCCAGCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 33} {0: 1, 1: 0, 2: 2, 3: 22, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!